Sequence formats: plain text and fasta formats
Tips:
- Always use the fonts 'courier' or 'courier new.' These fonts have letters with equal widths which is ideal when aligning sequences.
e.g., ATCCGGGCTATGTGT or atctgtgtataagtgtgttgtg
- You can either use uppercase or lowercase letters. Sometimes, you can alter the cases to indicate a special segment of a sequence. Altering the case is better than using underline, bold, italics, or different colors or highlights because all these formatting styles may be lost on repeated copying and pasting.
e.g., ATCTGTGTGGTTAATATAGTATA
- Fasta sequence format is ideal with the use of multiple sequences as it allows to isolate sequence identifiers from the rest of the sequence text.
Read the details on fasta format here.